Dental Plaque as a Probable Helicobacter Pylori Reservoir kadhum Muayad Mahdi1, Shareef Hasanain Khaleel2,* 1Laboratory Units, General Shomali Hospital, Babylon Health Directorate, Iraq 2Biology Department, College of Science for Women, University of Babylon, Iraq *Corresponding Author: Hasanain Khaleel Shareef, Biology Department, College of Science for Women, University of Babylon, Iraq, Email: hassanein2008@yahoo.com
Online published on 23 December, 2019. Abstract Background The natural reservoir and the specific mode of transmission for Helicobacter Pylori are unknown. Although the importance of H. Pylori culturing resides in the knowledge gained about their growth characteristic. Polymerase chain reaction had demonstrated great sensitivity and specificity than considered as the optimal method for identifying H. Pylori DNA in the oral cavity. The goal of this study was to investigate the occurrence of H. Pylori in the oral cavity with the biochemical characteristics and molecular identification of its strains by culturing and targeting 16S ribosomal RNA. Method During the period of study, a total of 95 dental plaque samples from patients in the age group (6–65 years) were collected. Dental plaque sample was discrete separately in 3ml of urea broth with urea supplement to detect the urease activity through change in color after one night and in 3ml of trypticase soy broth with 5% serum for proliferation and activation of microorganisms presenting in the plaques. Results Urease-positive activity was detected in 53(55.9%) out of the 95 samples. Then, just ureasepositive specimens were cultured in chocolate agar under standard conditions for these bacteria. Only 11(11.7%) out of 53 urease-positive samples showed positive results according to biochemical test and morphologic characters. The isolated bacteria were confirmed by one sets of 16S ribosomal RNA primer F (AGAGTTTGATCCTGGCTCAG), R (GGTTACCTTGTTACGACTT) were used for PCR after total DNA extracted from isolated colonies of bacteria by specific methods. Pure DNA for 28(52%) of 53 samples was amplified with universal primer that we chose and yielded 1500bp DNA product when monitored by 1.5% agarose gel and visualized by UV-light instrument. Twenty-five (47.16%) out of 53 samples displayed negative results. Conclusion We believe that it is necessary to pay close attention to dental plaques as a second reservoir of H. Pylori colonization and possible source of infection. In this study we found the presence of H. Pylori was more in healthy children dental plaques than in adult patients, perhaps related to their living conditions. Top Keywords Helicobacter pylori, polymerase chain reaction, dental plaque, Chocolate agar, urease-positive. Top |