Detection of visceral leishmaniosis in feral dogs in Bangladesh by conventional and molecular methods Chowdhury G.A.1, Habib M.A.1, Rima U.K.1, Hossain M.Z.1, Ruba T.1, Islam M.S.1, Labony S.S.1, Das Priya M.1, Khan M.A.H.N.A.1 1Department of Pathology, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh *Address for Correspondence M.A.H.N.A. Khan, Department of Pathology, faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh, e-mail: hadi.khan@bau.edu.bd
Abstract An investigation was carried out to recognize the occurrence of visceral leismaniosis(VL) in cattle, goats and dogs in the endemic zone of VL at Mymensingh district, Bangladesh. Venous blood, liver and spleen from the cattle, goats and dogs (50 from each) were collected from slaughter house during 2011 to 2015. Detection of the parasite was through examination of stained smear, histopathology and using polymerase chain reaction (PCR) technique. The investigations have revealed amastigote stage of Leishmania in the splenic smears of three dogs. Microgranulomas were seen in the liver of two dogs but amastigote stage of the parasite was not seen in the cytoplasm of macrophages. The PCR protocol was carried out using DNA from the blood, liver and spleen, targeting kinitoplast minicircle DNA (kDNA). A 145bp fragment of kDNA gene was amplified in positive cases of one cattle, seven goats and seven dogs. Two more PCR protocols were, adapted targeting 18S rRNA and cysteine proteases genes to support this observation. Genomic DNA from the blood, spleen and liver of cattle, goats and dogs while used in PCR amplified 18S rRNA and cysteine proteases gene specific fragments of Leishmania donovani in the spleen of two dogs. Phylogenetic analyses of 741bp fragment of the cysteine proteases gene confirmed that the protozoa as L. donovani. PCR protocol targeting 18S rRNA and cysteine proteases genes of Leishmania was found to be specific to detect L. donovani. This is the first report from Bangladesh confirming the visceral leishmaniosis in feral dogs using PCR. Thus, further investigations involving canids and other carrier animalsis required to curtail the incidence and or successful designing of VL eliminationcampaign in Bangladesh. How to cite this article: Chowdhury, G.A., Habib, M.A., Rima, U.K., Hossain, M.Z., Ruba, T., Islam, M.S., Labony, S.S., Das, PM. and Khan, M.A.H.N.A. Detection of visceral leishmaniosis in feral dogs in Bangladesh by conventional and molecular methods. (2019). Indian J. Vet. Pathol., 43(1): 28–33 Top Keywords Visceralleishmaniasis, detection, Carrier, Dog, PCR, Phylogeny. Top |
INTRODUCTION The visceral Leishmaniosis (VL) is known as kala-azar, black fever, Dumdum fever etc. andis caused by Leishmania donovani (L. donovani) and L. chagasi (L. infantum). The disease is transmitted by the bites of sand fly and second-largest parasitic killer of human in the world after malaria1,2-3. Signs and symptoms of VL included fever, weight loss, mucosal ulcers, fatigue, anemia and substantial enlargement of the liver and spleen and death. The pathology, ecology and epidemiology of leishmaniasis are affected by the behavior of hosts (human), reservoir (canides and other animals), vector (sandfly) and environment. |
The disease was first reported in Jessore district of East Bengal (present day, Bangladesh) in 18244 but almost disappeared in the early 1960s as a collateral benefit for the eradication of malaria through indoor residual spraying of DDT5. Nonetheless, in Bangladesh, sporadic kala-azar cases started rising in 1970 and re-emerged in Pabna district in 19806. The disease is stillconsidered as a major health concern and about 20 million people are at risk7. There are 16 Upazillas (sub-districts) that report 1.06 to 18.25 VL cases per 10,000 populations per year on a regular basis8 In the last decade, 90% of total cases of VL in Bangladesh were reported from 10 districts and about 50% of total cases were reported in Trishal and Fulbaria Upazillas of Mymensingh district. In recent year, there was tremendous reduction of VL in Bangladesh but total elimination was not achieved even after massive funding from Centers for Disease Control and Prevention (CDC). |
Since, the disease has been reported to occur in both wild and domestic animals1,9,10, the likelihood of their involvement in transmission of this disease to the humans is bright. VL is mostly diagnosedby detecting leishmania antibodies in serum, amastigote stage of the parasites in macrophages or genomic DNA in tissue specimens by polymerase chain reaction (PCR) technique11. Most routinely used methods to detect VL in the humansare to stain blood smears and aspiration biopsysmears from the spleen and or liver12. PCR based assay has been considered as highly sensitive and specific as the detection tool to diagnose VL in the humans13,14 and canides15. This study was aimed to investigate the presence of Leishmanial protozoa in the carrier animals by staining of blood and impression smears. Presence of leishmanial protozoa in animals was confirmed by PCR technique. Sequencing and phylogenetic analysis of the selected gene were also carried out to detect the specific cause of VL. |
Top MATERIALS AND METHODS Collection of samples Slaughter houses of Fulbaria and TrishalUpazilla, Mymensingh district, Bangladesh were selected for this study. Locally reared cattle (n=50) and goats (n=50) destined for meat market were examined at slaughter. From a stray dog elimination campaign (elderly, emaciated, carrier of rabies, having tumors etc.) in Bangladesh during 2012 - 2014, a total of 50 stray dogs were captured by the dog catchers at Fulbaria and Trishal Upazilla, Mymensingh district were deeply sedated with diazepam16 and euthanized by intracardiac injection of saturated solution of magnesium sulphate. Before sacrifice of the cattle and goats at slaughter and the dogs in the field, venous blood was collected into the heparinized test tubes. Following sacrifice, portion of the liver and spleen from the cattle, goats and dogs were aseptically collectedin cryotubes, snap frozen and shifted to the laboratory, Department of Pathology, Bangladesh Agricultural University, Mymensingh, Bangladesh. Portion of liver and spleen were collected in 10% buffered neutral formalin and used in histopathological detection of leishmanial lesions. Giemsa staining of smears Smears onto the clean slides were made with heparinized blood. Impression smears from the freshliver and spleen were made onto the sterile and clean slides. The smears were air dried, fixed in ice cold methanol by incubating at 4!. The slides wereair dried and placed in Coplin jar containing working Giemsa‘s solution17 to stain for 50 mins. Slides were washed in running tape water for 30 secs, dried in air and examined at high power (40x and 100x) microscopic fields to visualize amastigote stages of the parasite. Histopathological examination Portion of liver and spleen from the cattle, goats and dogs were fixed in 10% buffered neutral formalin and stained with H&E and Giemsa17. The stained sections were examined at low (10x) and high power (100x) microscopic field. The images were captured using a microscope connected with automated computer (Microimaging, Carl Zeiss Microscopy GmbH Carl-Zeiss- Promenade 1007745 Jena, Germany). PCR detection and differentiation of leishmanial in- fectivity PCR protocol was adapted targeting kinitoplast minicircle DNA (kDNA) of L. donovani. The DNA samples (50 from each) obtained from the blood, liver and spleenof cattle, goats and dogswere tested in uniplex PCR18,19-20. Genomic DNA from the buffy coats, liver and spleen was extracted using phenol chloroform and isoamyl alcohol precipitation methods10 (Labony et al., 2014). The DNA samples were evaluated quantitatively and qualitatively using spectrophotometry (A260 and A280) and agarose gel electrophoresis21. The PCR protocol amplified 145bp fragments with the DNA from a cattle, 07 goats and 07 dogs but amastigote stages of the protozoa was only seen in thesplenicsmears of three dogs. This observation raised possibilities to yield false positive reactionin PCR targeting kDNA gene. Two more PCR protocols were, therefore, adapted targeting 18 SrRNA and cysteine proteases genes of L. donovani. Three PCR protocols were standardizing with the known positive human DNA using published primers (Table 1). The cysteine proteases gene was targeted in PCR to differentiate infectivity in animals due to L. donovani (741bp amplicon) and L. infantum (702bp amplicon). The PCR was carried out in 25μl reaction volume containing 12.5μl PCR master mix (2×), 20pmol (0.5il) primer of each, 5μl (150-200ng) genomic DNA and nuclease free H2O to make 25μl volume. A total of 35–40 cycles of PCR amplification reactions was carried out in the thin walled PCR tubes (Eppendorf, Germany) for each of the genes targeted. PCR amplicons were electrophoresed in 1.5% agarose gel, stained with ethidium bromide and examined under UV light using an image documentation system (Cell Biosciences, Alphalmager HP, USA). Sequencing and phylogenetic analysis of cysteine protease gene The PCR amplicons of cysteine protease gene b (cpb) from the known positive human and dog samples were gel purified and cleaned with Wizard® SV Gel and PCR Clean-Up System (Promega, USA). The amplicons (75μl) with their forward and reverse primers (100poml of each) were sequenced fromlst BASE Laboratories SdnBhd, Malaysia. The raw sequence data obtained were first checked for its quality and then edited and assembled with the programmes Chroma Lite, Edit Seq and Meg Align. Edited sequences were aligned with MEGA6 programmes22. Multiple alignments were done with Clustal W algorithm and Maximum Likelihood phylogenetic trees were constructed with MEGA6 programme. The stability of the nodes in the phylogenetic trees was tested by boots trapping value with 500 replications. The evolutionary distances were computed using the Kimura-2 parameter method and were in the units of the number of base substitutions per site. The rate variation among sites was modeled with a gamma distribution (shape parameter = 1). The amplicons derived from the kDNAand 18SrRNA gene based PCR yielded very short fragments and hence these genes were not used in phylogenetic analysis. Top RESULTS Giemsa staining of smears Smearsstained with Giemsa showed amastigote stage of protozoa in the splenic macrophages (Fig. 1a, b) of three dogs. These dogs were suspected as carrier of VL. Amastigote stages of leishmanial protozoa were not seen in the macrophages of any of the smears prepared from the cattle and goats. Staining of tissue sections Sections of liver and spleen stained with H&E and Giemsa‘s showed microgranulomas in the liver of two dogs (Fig. 1c). The macrophages of microgranulomas did not contain amastigote stage of leishmanial body. PCR detection of VL DNA extracted from the blood, liver and spleen of cattle (n=50), goats (n=50) and dogs (n=50) when used in PCR targeting kDN A gene amplified 145bp fragment in a cattle, 07 goats and 07 dogs (Fig 2a). These DNAs were further tested in two more PCR and amplified 311bp and 741bp fragments specific for 18S rRNA and cysteine proteases genes of L. donovani, respectively in two dogs (Fig. 2b, c; lane 1, 3). Two dogs were found to carry L. donovani, a causal agent of VL in their spleen. The human known positive sample simultaneously used in PCR detection of 18S rRNA (311bp) and cysteine proteases (741bp) genesof L. donovani yield positive amplification reaction. PCR amplification of 702bp fragment of cysteine proteases gene, suggestive infectivity due to L. infantum was not seenin any case. The amplified DNA of cysteine proteases gene was used in sequencing and phylogenetic analysis. Sequencing and phylogenetic analysis The PCR amplicon of cysteine proteases gene (741bp) was sequenced through both the directions. The DNA amplicons of PCR positive dogs (MG519791- BAU TL MD1 2014) and known positive human (MG519792- BAU TL MH1 2014) were submitted to Genbank and aligned with the from NCBI homepage using BLAST algorithm. The phylogenetic analysis of the fragments of cysteine proteases gene distinctly clustered the organism into L. donovani (Fig. 3). The cysteine proteases gene sequences of both the dogs showed 100% identity and hence one sequence was submitted in Genbank and used in phylogenetic analysis. Top DISCUSSION Literature available indicated that persistence of carrier animals23, drug resistance against VL24 or unidentified endemic foci25 may cause emergence and spread of this neglected zoonosis. For active case detection, the recombinant K39 immuno-chromato graphic test (rK39 ICT) is routinely used in suspected human cases, which is simple, non-invasive and accurate. This diagnostic parameter can vary due to extensive diversityof the kinesing eneencoding for the K39 antigen26 among strains of L. donovani. Host variability, geographical and environmental factors may also influence the variation in test results27,28. The promastigote antigens K39 of leishmania cross-react with sera derived from known positive malaria and Chagas disease29. Thus, the test protocol used to detect VL in man and animals by using K39 antigen may not always confer accuracy. However, the test protocolsused to detect VL in carrier animals is lacking in Bangladesh and the carrier animals of VL could not have been identified unequivocally. Thus, the role of animals intransmitting VL in human isyet to be revealed. The latent but not overt cases in humans are considered as the reservoir for L. donovani infection in Bangladesh7. Accordingly, designing sensitive technology to detect carrier animals of VL in Bangladesh is a necessity. |
Traditionally, demonstration of parasites in either tissue smears or buffy coat from peripheral blood is the recognized gold standard to diagnose positive VL cases or carrier hosts30. Since, the sensitivity of this diagnostic assay from peripheral blood is poor (due to nocturnal periodicity of the protozoa), especially, when the blood is collected at day time. However, collection of blood at evening time orsmears from either spleen or bone marrow31 may assist effective sampling and diagnosis. Testing the splenic smears has been shown to have 93–99% sensitivity, while smears from other body tissues have sensitivities32,33 ranged between 50–86%. The major hurdle remains with the collection of biopsy samples from bone marrow and visceral organs. To identify the type of carrier animals and track the existence of VL in animals, PCR based diagnostic technique was thus adapted following extraction of DNAs from blood, liver and spleen of cattle, goats and dogs at necropsy. |
In fact, the true incidence of kala-azar in animals is poorly defined in Bangladesh; 90% of total cases of human VL were reported from 10 districts and among them, more than 50% of cases were reported in Mymensingh District5,15. Out of 12 Upazilla of Mymensingh district, 5 Upazillas were confirmedly reported to have kala-azar in human but information about the occurrence of VL in carrier animals is lacking. Canids are the commonly reported animals that were found to be infected with VL34. Around 70 animal species, including humans, have been reported to act as natural reservoir of leishmania parasites. Among the carrier animals, dogs are dominating due to their proximity to the human shelter. The incidence of VL in Golden jackals (Canis aureus) living in and around Bangladesh Agricultural University (BAU) campus35 and goats10 in Fulbaria Upazilla, Mymensingh district was reported earlier using PCR targeting kDNA gene19. Leishmanial infections were also determined in cows (5%), buffaloes (4%), and goats (16%) in Nepal by using traditional and molecular test protocol27. There is little information about the occurrence of VL in feral dogs15. Feral dogs in Bangladesh breed faster and survive by consuming garbages in the open market places and households. Cattle, buffaloes, sheep, goats, dogs and other domesticated species are living close to farmers, thus may contact the infection and act as carriers of VL. Detection of leishmania protozoa in carrier animals is a major hurdle due to lack of appropriate sampling methods and or availability of pre-defined techniques. |
In this study venous blood, liver and spleen from cattle, goats and dogs were collected at necropsy from Trishal and Fulbaria Upazillas, Mymensingh district. Amastigote stage of leishmania was only seen in the splenic smears of three dogs. The amastigote stage of the parasite was not seen in the smears prepared from cattle and goats. Yet, DNA extracted from the buffy coats and splenic as pirates found to generate kDNA gene specific amplicon in PCR19. The PCR protocolamplified kDNA gene specific fragment (145bp) of leishmanial protozoa, in one cattle, seven goats and seven dogs. None of the smears of cattle and goats showed the presence of amastigote stage of protozoa but the PCR test protocol generated kDNA gene specific amplicon, thus the PCR test protocol used were further validated. The extracted DNA from cattle, goats and dogs were, tested with two more PCR protocols targeting 18SrRNA20 and cysteine proteases13 genes. Genomic DNA from the cattle, goats and dogs used in PCR, 18SrRNA and cysteine proteases gene specific amplicons were generated in two dogs. None of the DNA from cattle and goats found to amplify 18SrRNA and cysteine proteases gene specific fragment. |
The PCR protocol adapted targeting cysteine protease gene of L, Donovani (741bp) or L, infantum (702bp) in this study generated 741bp amplicon in two dogs. Three dogs although carried amastigote stages of protozoa in their splenic smears, two dogs were confirmedly infected with L, Donovani. One dog may have carried other leishmanial protozoon, require further investigation. Known positive human samples were always included in the PCR protocols to evaluate accuracy of the test protocols. The phylogenetic analysis carried out using the cysteine proteases gene (741bp) of humans and dog samples clustered the parasite belonging to L, Donovani, The existence of L, infantum in dogs was not identified from this study. The PCR protocol standardized in this study10,19,35 targeting to amplify kDNA gene lack the specificity of the reaction to L, Donovani or L, infantum. The cysteine proteases gene served as a marker for the differentiation of L, Donovani and L, infantum, highly conserved in amastigote stage13 and may be used to identify and differentiate infectivity due to L. Donovani and L, infantum. The limitation of this study was to convince owners about the occurrence of VL in their animals and collection ofsamples from the animals that were suspected. Thus, more awareness campaigns are required. |
Impression smears prepared from the blood, liver and spleen of cattle, goats and dogs when stained with Giemsa‘s showed amastigote stage of leishmanial protozoa in three dogs. The fragment of kDNA gene targeted in PCR detection of VL lacked its species specificity. PCR amplification of 18SrRNA and cysteine proteases gene of L, Donovani were more specific and cysteine proteases gene can be used as marker to differentiate infectivity due to L, Donovani and L. infantum. The status of dog as a confirmed carrier of L, Donovani was usually made by impression smears in positive cases when the splenic smears were used. This is the first report from Bangladesh confirming the visceral leishmaniosis in feral dogs using PCR. It warrants further investigation to see if L, Donovani has started crossing species barrier and diverting anthroponotic nature of VL to zooanthroponosis. |
Top ACKNOWLEDGEMENTS We thank Sponsored Public Good Research (SPGR), Project Implementation Unit (PIU), Bangladesh Agricultural Research Council (BARC), National Agricultural Technology Programme (Phase 1), Farm Gate, Dhaka, Bangladesh for funding this research. Thanks are due to SuriyaKanta Kala-azar Research Center, Mymensingh, Bangladesh for shearing known positive human DNA to compare the observation. |
Top ETHICAL APPROVAL The experiment was conducted following the recommendation and guide lines of the National Animal Welfare Committee (NAWC), Bangladesh Veterinary Council (BVC) under the section 1 of invasive and noninvasive procedure (Permit number: 01/01/2015/NAWC). |
Top Figures | Fig. 1.: (a&b) Splenic smears of dog stained with Giemsa‘s and examined under microscope showed amastigote stage of protozoa, (Giemsa x1000). Infected monocytes found to engulf (a, arrow) and liberate (b, circle) amastigote stage of protozoa; (c) Microgranuloma was seen in the liver of dogs but lacking leishmanial amastigote in the cytoplasm of macrophages, H&E ×100.
|  | |
| | Fig. 2.: PCR detection of kDNA (145bp), 18S rRNA (311bp) and cysteine proteases (741bp) genes of L. donovani. The lane L is for 100bp ladder, PC is for positive control, NC is negative control and lane numbers are for test samples. Out of 50 cattle, 50 goats and 50 dog‘s samples tested in PCR, kDNA specific 145bp amplicon was generated in a cattle, 7 goats and 7 dogs (a, arrows). Only 2 samples of canine origin were found to generate 18S rRNA (311bp, b, arrows) and cysteine proteases (741bp, c, arrows) gene specific amplicons of L. donovani.
|  | |
| | Fig. 3.: MaximumLikelihood tree was constructed based on cysteine proteases gene (741bp) of Leishmania sp. Phylogenetic analysis was carried out using cysteine proteases gene of human (MG519792 BAU TL MH1 2014) and dog (MG519791 BAU TL MD1 2014) samples clustered the protozoa belonging to L. donavani strain of MHOM/IN/00/DEVI.
|  | |
|
Table | Table 1.: Oligonucleotide primers used to amplify fragment of genomic DNA of L. donovani and L. infantum. The primers were synthesized commerciallyfrom First BASE Laboratories SdnBhd, Malaysia and the PCR kit used was from QIAGEN LIMITED, UK.
| | Primers name | Sequences (5'-3') | Gene/ampliconSize | | TLDF | cttttctggteccgcgggtagg | Kinitoplastminicircle | | TLDR | ccacctggcctattttacacca | DNA (kDNA)/145 bp19 | | T18SLDF | cgtaacgccttttcaactcac | 18Sr RNA/311bp20 | | T18sLDR | gccgaatagaaaagatacgtaag | | | TcpbEF | cgtgacgccggtgaagaat | Cysteine proteases13 | | TcpbER | cgtgcactcggccgtctt | 702 bp (L. infantum) 741 bp (L. donovani) |
| |
|