Patho-epidemiology of respiratory disease complex pathogens (RDPs) in commercial chicken Kaore Megha3, Singh K.P.3,*, Palanivelu M.1,3, Kumar Asok M.1,3, Reddy M.R.1,3, Kurkure N.V.2,3 3Centre for Animal Disease Research and Diagnosis (CADRAD), ICAR-IVRI, Izatnagar, Bareilly, Uttar Pradesh; 1Division of Pathology, ICAR-IVRI, Izatnagar, Bareilly, Uttar Pradesh; 2Department of Veterinary Pathology, Nagpur Veterinary College, Nagpur, Maharashtra, India *Corresponding author: e-mail: karam.singh@rediffmail.com
Abstract Respiratory disease complex (RDC) has emerged as a challenge to poultry industry. A total of 534 chicken suspected to have died of respiratory disease caused by pathogens such as Newcastle disease virus (NDV), infectious bronchitis virus (IBV), low pathogenic avian influenza virus (LPAIV), infectious laryngotracheitis virus (ILTV), metapneumovirus and fowl adenovirus infections (FAdV), Escherichia coli, Pasteurella multocida, Avibacterium paragallinarum, Ornithobacterium rhinotracheale (ORT) and Mycoplasma gallisepticum (MG) were screened by polymerase chain reaction and the pathological lesions were characterized. Of these 534 chickens with respiratory pathology, 457 (85.58%) were found to be positive for at least one of the screened pathogens. Among these 457 positive cases, 227 (48.67%) cases revealed infection by single screened pathogen (monoinfection), while 230 samples (50.33%) had concurrent infections by two to five pathogens in a single case. Among different pathogens, NDV could be detected in 265 cases (57.99%) either as single infecting agent or in combination with other viral or bacterial pathogens, followed by LPAI-H9N2 in 132 cases (28.88%), E. coli in 115 cases (24.95%), respiratory mycoplasmosis in 82 cases (17.94), infectious bronchitis in 47 cases (10.28%), infectious laryngotracheitis in 35 cases (7.66%), FAdV infection in 8 cases (1.75%), fowl cholera in 7 cases (1.53%), and ornithobacteriosis in 3 cases (0.66%). From these findings it was concluded that concurrent infections by several genotypes of NDV, H9N2 strain of AIV-A, IBV, E. coli and MG are the leading cause of respiratory disease complex in chicken, while pathogens such as ILTV, FAdV and ORT are emerging as potential threat to poultry industry. Top Keywords Chicken, Concurrent infections, Pathology, Respiratory disease complex. Top |
INTRODUCTION Poultry is one of the fastest growing segments of the agricultural sector in India with around eight percent growth rate per annum1. Quantum growth exhibited by the Indian poultry industry in the last four decades is phenomenal. With an annual production of 82,000 million eggs and 4.2 million tons of poultry meat in 2016, India is now among the biggest egg and broiler producers in the world. In spite of this rapid development in the Indian poultry sector, infectious diseases contribute to significant economic losses. The incidence and severity of respiratory diseases in commercial chicken flocks have increased recently in India because of the intensification of the industry that facilitates the rapid spread of multiple pathogens. The etiology of RDC involves more than one pathogen at a time2,3-4. The most important respiratory diseases of poultry include avian influenza, particularly its low pathogenic form (LPAI), Newcastle disease (ND), infectious bronchitis (IB), infectious laryngotracheitis (ILT), infections by avian metapneumovirus (APMV), fowl adenoviruses (FAdV), avian pathogenic E. coli, Pasteurella multocida, Ornithobacterium rhinotracheale (ORT) and respiratory mycoplasmosis. Among these diseases LPAI, ND, IB, and ILT are highly contagious diseases of poultry, distributed worldwide, affecting the chicken of all ages, and have serious economic impacts on the poultry industry. All these diseases affect a bird‘s respiratory system and produce almost similar clinical signs and lesions which often makes the diagnosis challenging. The severity of lesions is often exacerbated and prolonged by concurrent infections. |
Low pathogenic avian influenza (LPAI) strains cause fewer losses compared to HPAI strains, and they may complicate the poultry health situation by facilitating precipitation of co-infections in poultry flocks with other pathogens such as NDV, IBV and even other highly pathogenic avian influenza viruses such as H5N15. All ND viruses belong to a single serotype (APMV-1); however, different isolates differ in virulence in poultry, which translates into a wide range of clinical signs and gross lesions of NDV infections, often making it a challenge to recognize Newcastle Disease Virus (NDV) as the cause of the respiratory disease, morbidity and mortality in the field outbreaks. Although IB and ILT cause relatively less mortality than AI and ND, nevertheless they greatly reduce the productivity of the surviving birds leading to significant economic losses6. The status of concurrent infections by respiratory viral and/or bacterial pathogens in spontaneously infected poultry has been rarely analyzed and the epidemiology of etiologies involved in respiratory disease complex is largely unknown. Thus, we attempted to trace the pathogens which spontaneously induce, enunciate and complicate the pathology of RDC in chicken under field conditions. |
Top MATERIALS AND METHODS Sample collection The samples (n=534) were collected from chicken carcasses which had lesions primarily in the upper and lower respiratory tract including airsacs. The sources of sample included broiler and layer farms from Maharashtra (250), Uttar Pradesh (200), Haryana (30), Hyderabad (12), Bengaluru (12), and Namakkal (30). The age group of affected flocks ranged between 1 week and 70 weeks. The samples were preserved in 10% neutral buffered formalin for histopathology and immunohistochemistry, and fresh tissues from larynx, trachea, lungs and airsac were preserved in -20°C until nucleic acid extraction and molecular diagnostic confirmation. Gross and histopathology Systematic necropsy was carried out to examine the respiratory system including the airsacs. The upper respiratory tract and lungs were carefully removed and examined for lesions if any changes. The respiratory tract with gross pathological changes including congestion, exudations, abnormal thickening, consolidation of lungs and other inflammatory lesions, if any were recorded and photographed. A total of 534 respiratory tract which had lesions primarily in the respiratory tract including airsacs were collected from chicken broiler and layer carcasses from poultry farms located in the states of Maharashtra, Uttar Pradesh, Haryana, Telangana, Karnataka and Tamilnadu. The age group of affected flocks ranged between 1 week and 70 weeks. The samples were preserved in 10% neutral buffered formalin for histopathology and immunohistochemistry, and fresh tissues from larynx, trachea, lungs and airsac were preserved in -20°C until nucleic acid extraction and molecular diagnostic confirmation. The formalin fixed tissues were processed for paraffin embedding. Five micron thick sections were cut and stained by routine Hematoxylin & Eosin staining. The stained sections of larynx, trachea, bronchi, lungs and airsacs were examined for pathological lesions. The histopathological lesions between mono infection and concurrent infections were examined and compared. Screening of Respiratory Disease Complex Pathogens The samples were screened for important viral diseases viz. Newcastle disease, infectious bronchitis, low pathogenic avian influenza, infectious laryngotracheitis, fowl adenovirus infection and bacterial diseases such as avian pathogenic E. coli infection, fowl cholera, infectious coryza, ornithobacteriosis and avian mycoplasmosis by polymerase chain reaction (PCR). The details of primers used for screening of different respiratory viral and bacterial pathogens are given in Table. 1. Genomic DNA and total RNA was extracted from tissue homogenate (lungs, trachea, spleen and airsacs) using DNeasy Tissue kit (Qiagen, Germany) and QIAzol lysis reagent (Qiagen, Germany), respectively as per the manufactured s protocol. Reverse transcription was performed using revert aid first strand cDNA synthesis kit (Thermo Scientific, Carlsbad). The extracted DNA and RNA were quantified and PCR was carried out in mastercycler gradient (Eppendorf, India) using Dream Taq PCR master mix (Thermo Fisher Scientific, Carlsbad). The RT-PCR conditions to amplify F gene of NDV, M gene of AIV and N gene of IB, was standardized at an initial incubation of 95°C for 5 min, followed by 35 cycles of denaturation at 94°C for 45 sec, annealing 56°C for 45 sec, extension 72°C for 45 sec and final extension at 72°C for 7 min. To confirm involvement of DNA viruses and bacterial pathogens, PCR was carried out to amplify p32 gene of ILTV, hexon gene of FAdV, iroN gene of E. coli, 16s rRNA gene of ORT, 16s rRNA gene of Mycoplasma gallisepticum. The cyclic condition for amplification of p32 gene of ILTV, iroN gene of E. coli, and fowl cholera was standardized as initial incubation at 95°C for 5 min, followed by 35 cycles of denaturation at 94°C for 45 sec, annealing at 56°C for 45 sec, extension 72°C for 45 sec and final extension at 72°C for 10 min. The annealing temperature to amplify 16s rRNA gene of ORT and Mycoplasma gallisepticum were 52°C for 60 sec and 45°C for 45 sec respectively. Eight (8) μL of amplified PCR product was mixed with 2 μL of 6× tracking dye (Qiagen, Germany) and loaded on a 1.0% agarose gel containing 0.5 μg/ml ethidium bromide. Hundred base pair (100 bp) DNA molecular marker (Qiagen, Germany) was also loaded along with the amplified PCR product. The amplicons in agarose gel were separated by a horizontal gel electrophoresis system (Takara, Japan) containing 0.5× Tris Borate EDTA (TBE) buffer, and visualized under UV transilluminator (MultiImageTM Light Cabinet, Alpha Innotech Corporation, San Leandro, USA). Top RESULTS Gross pathological changes Birds which have died in acute or subacute stage externally revealed conjunctivitis, nasal discharge, swollen sinuses, and purulent exudate in sinus and on mucous membrane of mouth. Grossly, trachea revealed mild to moderate congestion especially around the rings and catarrhal to mucopurulent or fibrinopurulent exudate in the lumen. In ND and LPAI co-infections, trachea revealed severe diffuse haemorrhagic tracheitis and tracheal and bronchial lumen were partially or completely occluded by caseous plugs. Lungs revealed severe congestion, edema, and deposition of fibrin on the pleural surface of edematous lungs. In IBV and co-infected cases, lungs were diffusely congested and revealed patchy consolidation of lung parenchyma along with caseous casts in bronchi. In IBV-E. coli concurrently infected cases, the lumen of air sacs were filled with purulent exudate. In ILTV infections, tracheas revealed congested mucosa to severe diffuse haemorrhagic to fibrino haemorrhagic tracheitis with fibrino-haemorrhagic to fibrino-purulent exudates in the lumen. In E. coli-Mycoplasma combine infections, the air sacs revealed purulent to fibrinopurulent exudate in the lumen, fibrinous pericarditis, perihepatitis, airsacculitis were present. In E. coli-ORT and FAdV co-infections severe congestion of trachea, pneumonia and purulent airsacculitis with frothy exudates in abdominal air sac was present (Fig. 1a-f). Molecular screening and incidence of different infections The diagnostic PCR targeting amplification of F gene of NDV, M gene of LPAI, N gene of IBV, and p32 gene of ILTV yielded product of 356 bp, 244 bp, 402 bp and 588 bp, respectively (Fig. 2a-d). The primer set to amplify hexon gene of FAdV, iroN gene of avian pathogenic E. coli, gene encoding 16S rRNA of Ornithobacterium rhinotracheale (ORT) and Mycoplasma gallisepticum have yielded specific amplicons of 900 bp, 667 bp, 784 bp and 185 bp, respectively (Fig. 3a-d). PCR to amplify 16S rRNA of Pasteurella multocida yielded an expected amplicon of 564 bp in positive cases. Out of 534 samples screened, 457 samples (85.58%) were positive at least for one respiratory viral or bacterial pathogen. Among positive cases, 227 (48.67%) samples had infection by single screened pathogen, while 230 samples (50.33%) had concurrent infections by different viruses or bacteria of pathogenic potential. Out of these 457 positive samples, 87 (16.29%) samples were positive for ND, 2 (0.37%) for ND and IB, 74 (13.86%) samples for ND and LPAI, 4 (0.75%) samples for ND and FAV, 59 (11.05%) samples for ND and E. coli infections, 33 (6.18%) samples for ND and CRD, 1 (0.19%) for ND and fowl cholera, 5 (0.94%) samples for ND, CRD and E. coli infections, 27 (5.06%) samples for IB, 9 (1.69%) samples for IB and LPAI, 6 (1.12%) samples for IB and E. coli infections, 2 (0.37%) samples for IB and CRD, 1 (0.19%) sample for IB and FAdV, 25 (4.68%) samples for LPAI, 14 (2.62%) samples for LPAI and E. coli infections, 6 (1.12%) samples for LPAI and CRD, 30 (5.62%) for ILT, 4 (0.75%) for ILT and LPAI, 22 (4.12%) samples for E. coli infections, 6 (1.12%) samples for E. coli infections and CRD (1.12%), 1 (0.19%) sample for E. coli and ORT infections and 1 samples (0.19%) for E. coli and FAdV infections, 1 for (0.19%) with ORT and FAdV infections, 6 (1.12%) samples for fowl cholera, 1 (0.19%) sample for ILTV, FAdV, ORT and E. coli infections and 30 samples (5.62%) for CRD. The incidence of different infections is consolidated and presented in Table 2. Among different pathogens associated with respiratory diseases, NDV could be detected in 265 cases (57.99%) either as single pathogen or in combination with other viral or bacterial pathogen, followed by LPAI in 132 cases (28.88%), E. coli infections in 115 cases (24.95%), CRD in 82 cases (17.94), IB in 47 cases (10.28%), ILT in 35 cases (7.66%), FAdV infections in 8 cases (1.75%), fowl cholera in 7 cases (1.53%), and ORT in 3 cases (0.66%). Histopathological changes Microscopically, mild to severe epithelial hyperplasia, loss of cilia, edema, lymphocytic infiltrates in lamina propria, and lymphoid nodule formation in the tracheal submucosa were the common findings in NDV infected cases. In ND and LPAI co-infected cases, tracheal and bronchial lumen revealed presence of heterophilic plugs which partially or completely occluded the lumen in addition to denudation of respiratory epithelium and destruction of mucosal glands. The lungs showed moderate to severe congestion of capillaries and presence of necrotic plugs in the secondary and tertiary bronchioles (Fig. 4a-c). In IBV infection, trachea and bronchi revealed deciliation, hydropic degeneration, focal areas of epithelial necrosis accompanied with partial compensatory epithelial hyperplasia. In lungs, the mucosa of secondary bronchi and parabronchi were infiltrated by lymphocytes, macrophages and plasma cells along with peribronchial heterophilic infiltration. Characteristic lymphoid aggregates to large lymphoid nodules with germinal center formation were consistent in submucosa (Fig. 4d-g). In ILTV infections, larynx revealed hyperplasia of lining epithelial cells as well as goblet cells amidst mononuclear cell infiltration in the mucosa and fibrino-necrotic debris in the lumen. Trachea revealed partial to complete denudation of lining mucosa in few cases, while regenerative hyperplasia of epithelium, thickening of lamina propria due to infiltration of mononuclear cells and presence of syncytia and intranuclear eosinophilic inclusions that filled the entire nucleus were the common lesions observed in other ILTV positive cases (Fig. 4h-i). In severe cases, there was complete denudation of tracheal mucosa with the only single hyperchromatic basal layer. Tracheal lesion score revealed a non-significant difference in severity in ILT mono infection and co-infections (P>0.05). In complicated IBV-E. coli-Mycoplasma co-infections, lymphocytic infiltration forming germinal center were found especially around secondary bronchi and blood vessels and interatrial septa was thickened. In NDV-E. coli, NDV-Pasteurella, NDV-E. coli-Mycoplasma complicated cases, mixed heterophilic and mononuclear cell infiltration, predominated by macrophages were present but not specific. In NDV-FAdV coinfected cases, characteristic adenoviral intranuclear basophilic inclusion bodies in tracheal epithelium were evident. Tracheal and lung lesions revealed a significant difference in severity in mono infection and concurrent mixed infections (P<0.05). In Mycoplasma-E. coli complex, trachea revealed moderate to severe epithelial cell hyperplasia, infiltration of lamina propria by lymphocytes and histiocytes, dilation of the mucous glands, infiltration of submucosa with a mixed inflammatory cell population, and intraluminal cellular debris with bacterial colonies. Lungs revealed very severe diffuse fibrinous pneumonia characterized by large areas of necrosis with edema and accumulation of fibrin, heterophils in interstitial tissues, and bronchi. Lymphoplasmacytic infiltration in lamina propria, squamous metaplasia of lining epithelia, and presence of large lymphoid aggregates in peribronchiolar space were observed in few mycoplasmosis indicating chronic progressive bronchitis and airsacculitis. Air sac revealed epithelial destruction and abnormal thickening due to the proliferation of submucosal connective tissue, focal to diffuse lymphoid aggregates and neovascularization. A thick layer of fibrino-heterophilic exudate on the pleural surface was consistent in mycoplasmosis as well as fowl cholera caused by Pasteurella species. Tracheal lesion score showed the nonsignificant difference in severity between E. coli mono infection and co-infections with other pathogens (P>0.05). Top DISCUSSION The rapid development of poultry industry, international trade and movement of poultry and lack of biosecurity resulted in emergence and spread of many respiratory diseases. The results of the present study revealed the involvement of single and multiple etiological agents in various combinations. The findings of present study was in accordance with earlier report which reported presence of AIV (H9N2), NDV, avian metapneumo virus (aMPV), IBV, and MG with different combinations in a molecular survey conducted for respiratory pathogens in 115 broiler chicken flocks3. A survey on respiratory pathogens reported that 11 flocks (61%) were infected with AIV-H9N2, and virulent NDV; 4 flocks (22%) with virulent NDV; and 3 flocks (17%) were positive only for AIV. Three to seven etiological agents (CAV, FAV, ILTV, MG, MS and avian pathogenic E. coli) were associated with all 18 AIV-H9N2 affected flocks15. |
In the present study, concurrent infection was detected in 230 samples (50.33%). These findings are in line with earlier findings which reported 66.3% (57/86) mixed infection in broiler flocks16. Total 265 cases of NDV were detected either as single etiology or in combination with other respiratory pathogens. Though ND is alone capable of causing severe respiratory disease with high mortality in field condition, concurrent infection with other pathogens such as IBV, LPAIV, FAdV, APEC, and mycoplasma in present study caused very high mortality. Seventy four (74) cases were concurrently infected with NDV and LPAIV. There is widespread use of live lentogenic vaccine throughout the country so it can be presumed that the NDV vaccine along with environmental stress or other co-pathogens can exacerbate the AIV-H9N2 infection in chickens. These results are in accordance with previous reports where the mixed infection of AIV-H9N2 with other pathogens and live vaccines caused comparable mortality17,18. NDV usually causes damage to the tracheal epithelium, which leads to colonization of bacteria mainly E. coli and mycoplasma or impairment of the phagocytic activity and alteration of the innate immune response19. |
In 9 (1.69%) samples, concurrent infection of IBV and LPAIV was found. This synergistic mechanism between IBV and LPAI-H9N2 infection and pathogenesis is mediated possibly by trypsin-like proteases encoded by coronaviruses that enhance the AIV-H9N2 haemagglutinin cleavage20. IB cases concurrently infected with E. coli and mycoplasma in present study is supported by the earlier findings that the lesions caused by the IBV are sufficiently severe to permit E. coli and mycoplasma to invade the affected tissues and lead to generalized infection often with high mortality in chickens maintained under commercial set up21. The LPAI in the present study was found in association with ND, IB, ILT and E. coli infection. Concurrent infection of AI with other respiratory pathogens particularly, E. coli and Mycoplasma gallisepticum are responsible for severe clinical disease with subsequent high mortality20. ILTV was detected and isolated from four different geographical regions of country, Namakkal, Bengaluru, Hyderabad and Haryana. The concurrent infection of ILTV and LPAIV was found in 4 cases which are in agreement with an earlier report4. Though the ILTV itself can cause very high morbidity and mortality, concurrent infection by LPAIV could exacerbate the pathology. The occurrence of ILTV-LPAIV mixed infections might be due to the widespread use of ILT vaccine and circulation of LPAIV in the different geographical location of the country. FAdV could be detected in 8 cases (1.75%) in association with NDV, IBV, E. coli and ORT. This observation confirms the earlier report of fowl adenovirus association with respiratory disease9. ORT could be detected in 3 cases (0.66%) in association with E. coli, FAdV and ILTV. These findings are in agreement with earlier reports22,23. |
It was concluded that at least three genotypes have been associated with respiratory disease complex in commercial chicken populations in India but continuous surveillance need to be carried out to better understand the epidemiology of other NDV genotypes or avian paramyxoviruses associated with RDC. Since the NDV was the most frequently detected pathogen in the respiratory pathology in vaccinated as well as unvaccinated flocks, the efficacy of currently available ND vaccine against different NDV genotypes circulating in Indian chicken populations needs to be evaluated. LPAIV-H9N2 is widely spread in the different geographical region of the country and is often associated with RDC induced by other respiratory pathogens such as NDV, IBV, ILTV, FAV, E. coli, and mycoplasma. Infectious laryngotracheitis (ILT) is widely prevalent in southern states of India and re-emerging in Northern parts; however, its true epidemiology is under reported. Furthermore, the ILTV circulating in Indian chicken population is not known and thus molecular epidemiology of ILT need to be carried out to understand whether the tracheitis is induced by wild type ILT virus or live attenuated ILT vaccine virus. FAdV, once considered as secondary pathogen, is emerging as an important pathogen of respiratory disease complex. We detected serovar A of ORT in the present study; however, information on epidemiology ORT infection in poultry flocks is lacking, and hence continuous surveillance of ORT infection and serotyping is important to ascertain the involvement of other serotypes of ORT in Indian poultry population. A clear understanding of the interaction between the various pathological agents will help to make the better diagnosis and formulate intervention strategies including treatment modalities leading to better control of respiratory infections in poultry. |
Top ACKNOWLEDGMENTS Authors are thankful to the Director of Indian Veterinary Research Institute for providing facility and funds for carrying out the study. |
Top CONFLICT OF INTEREST There is no conflict of interest. |
Top Figures | Fig. 1.: Common gross pathological changes in RDCP infections: (a) Trachea from NDV infected layer chicken showing hemorrhages in the tracheal rings (H) and catarrhal exudates in lumen (M); (b) Respiratory tract from broiler chicken concurrently infected with NDV and LPAI-H9N2 showing severe congestion of tracheo-bronchi and lungs, and cheesy plugs obstructing the tracheo-bronchial lumen; (c) Trachea and lungs from IBV infected broiler chicks showing severe congestion of trachea and patchy consolidation of lungs; (d) Caseous plugs in the larynx and tracheal apperture of a broiler breeder infected by ILTV; (e) Mild congestion of trachea and marked consolidation of lung infected by FAdV- E. coli infection; (f) Thick inflammed thoracic and abdominal airsacs containing cheesy exudates in E. coli-M. gallisepticum infection.
|  | |
| | Fig. 2.: Electrophoretic seperation of PCR amplicons of major avian respiroto- ry viruses (a) Partial fusion gene of NDV (356bp); (b) Partial matrix gene of AIV-A (244bp); (c) Partial nucleoprotein gene of IBV (402bp); (d) Partial p32 gene of ILTV (588bp).
|  | |
| | Fig. 3.: Electrophoretic seperation of PCR amplicons of other RDC pathogens (a) Partial hexon gene of FAdV (900 bp); (b) Partial iroN gene of E. coli (688 bp); (c) Gene encoding 16S rRNA of ORT (784 bp); (d) Gene encoding 16S rRNA of Mycoplasma gallisepticum (185 bp).
|  | |
| | Plate 4.: Microscopic pathology in RDCP infections: (a) Section of trachea from NDV infected layer chicken showing vascular congestion, submucosal edema and infiltration by lymphoid cells in lamina propria as well as submucosa, H&Ex200; (b) Secondary bronchi from broiler chicken concurrently infected with NDV and LPAI-H9N2 showing vascular congestion, hyperplasia of BALT(*) and diffuse lymphiod infiltration, H&Ex200; (c) Lung from NDV-LPAIV concurrently infected broiler chicks showing necrotic plugs (NP) in the tertiary or parabronchial lumen, H&Ex100; (d) Necrotic plugs partially obliterating the tracheal lumen in IBV infected broiler chick H&Ex100; (e,f) Secondary bronchi from IBV infected chick showing vascular congestion and infiltration by lypmphoplasmacytic cells, H&Ex200 and H&Ex400, respectively; (g) Trachea from IBV infected layer showing multinodular lymphoid aggregates with distinct germinal centre (GC) formation H&Ex200; (h) Trachea from ILTV infected layer showing epithelial denudation, fibrinohemorrhagic exudates and mult- inucleated syncytia in the lumen, H&Ex200; (i) Higher magnification of mutinucleated syncytia (Sy) showing presence of intranuclear eosinophilic inclusion bodies (I/N-IB), H&Ex100.
|  | |
|
Tables | Table 1.: List of primers used for amplification of different genes of viral and bacterial pathogens
| | Pathogens | Gene | Primers (5' 3') | Product Size (bp) | Annealing Temp (!) | References | | IBV | N | F-AATTTTGGTGATGACAAGATGA R-CATTGTTCCTCTCCT CATCTG | 402 | 56 | Farsang et al. (2002) | | NDV | F | F- GCAGCTGCAGGGATTGTGGT R-TCTTTGAGCAGGAGGATGTTG | 356 | 56 | Ottiger et al. (2010) | | ILTV | p32 | F- CTACGTGCTGGGCTCTAATCC R- AAACTCTCGGGTGGCTACTGC | 588 | 56 | Ottiger et al. (2010) | | LPAI | M | F-CTTCTAACCGAGGTCGAAACG R-AGGGCATTTTGGACAAAKCGT | 244 | 56 | Ottiger et al. (2010) | | FAdV | Hexon | F-CAARTTCAGRCAGACGGT R-TAGT GAT GMCGSG AC AT CAT | 900 | 60 | Gowthman et al. (2012) | | Infectious Coryza | HPG-2 | F- TGAGGGTAGTCTTGCACCCGAAT R- CAAGGTATCGATCGTCTCTCTACT | 500 | 52 | Chen et al. (1998) | | Fowl | RGPMA5 | F- AAT GTTTGC GAT AGT CCG TTA GA | | | | | Cholera | RGPMA6 | R- ATT TGG CGC CAT ATC ACA GTC | 564 | 52 | Shivachandra et al. (2004) | | APEC | iroN | F- AAGTCAAAGCAGGGGTTGCCCG R- GACGCCGACATTAAGACGCAG | 667 | 55 | Jeong et al. (2012) | | ORT | 16S rRNA | F-GAGAATTAATTTACGGATTAAG R-TTCGCTTGGTCTCCGAGAT | 784 | 52 | Amonsin et al. 1997 | | M. gallisepticum | 16S rRNA | F-GAGCTAATCTGTAAATTGGTC R-GCTTCCTTGCGGTTAGCAAC | 185 | 45 | OIE (2008) |
| | | Table 2.: Different respiratory pathogen in positive samples
| | Pathogens | Total no. of positive cases | % | | ND | 87 | 16.29 | | ND, IB | 2 | 0.37 | | ND, LPAI | 74 | 13.86 | | ND, FAdV | 4 | 0.75 | | ND, E. coli | 59 | 11.05 | | ND, CRD | 33 | 6.18 | | ND, Fowl Cholera | 1 | 0.19 | | ND, CRD, E. coli | 5 | 0.94 | | IB | 27 | 5.06 | | IB, LPAI | 9 | 1.69 | | IB, E. coli | 6 | 1.12 | | IB, CRD | 2 | 0.37 | | IB, FAdV | 1 | 0.19 | | LPAI | 25 | 4.68 | | LPAI, E. coli | 14 | 2.62 | | LPAI, CRD | 6 | 1.12 | | ILT | 30 | 5.62 | | ILT, LPAI | 4 | 0.75 | | E. coli | 22 | 4.12 | | E. coli, CRD | 6 | 1.12 | | E. coli, ORT | 1 | 0.19 | | E. coli, FAdV | 1 | 0.19 | | ORT, FAdV | 1 | 0.19 | | Fowl Cholera | 6 | 1.12 | | ILT, FAdV, ORT, E. coli | 1 | 0.19 | | CRD | 30 | 5.62 |
| |
|